CleanPlex® for MGI Single-Indexed PCR Primers

$272.00$576.00

The CleanPlex® for MGI Single-Indexed PCR Primers are high-quality ready-to-use PCR primers for MGISEQ™ library construction. They are compatible and designed for use with all CleanPlex for MGI NGS Panels to construct targeted libraries for sequencing on an MGISEQ NGS platform.

SKU: N/A Category:

Product Description

The CleanPlex® for MGI Single-Indexed PCR Primers are high-quality ready-to-use PCR primers for MGISEQ™ library construction. They are compatible and designed for use with all CleanPlex for MGI NGS Panels to construct targeted libraries for sequencing on an MGISEQ NGS platform.

Primer Sequences:

Each sample is indexed by a pair of Indexed PCR Primers for sequencing on MGISEQ platforms.
XXXXXXXXXX denotes the index region of the primer.

Universal Primer

5′-Phos-GAACGACATGGCTACGATCCGACT*T-3’

Indexed Primers

5′-TGTGAGCCAAGGAGTTGXXXXXXXXXXTTGTCTTCCTAAGACCGCTTGGCCTCCGACT*T-3’

Note:

Please refer to the CleanPlex for MGI NGS Panel User Guide for instructions on using CleanPlex for MGI Single-Indexed PCR Primers

 

Storage Temperature:

Store at -20°C

 

For Research Use Only. Not for use in diagnostic procedures.

Product Documents

Additional Information

Pack Size (Reactions)

Set A 32, Set B 32, Set C 32, Set D 32, Set E 32, Set F 32, Set A 96, Set B 96, Set C 96, Set D 96, Set E 96, Set F 96