CleanPlex® for MGI Single-Indexed PCR Primers

$272.00$576.00

The CleanPlex® for MGI Single-Indexed PCR Primers are high-quality ready-to-use PCR primers for MGISEQ™ library construction. They are compatible and designed for use with all CleanPlex for MGI NGS Panels to construct targeted libraries for sequencing on an MGISEQ NGS platform.

Product Description

The CleanPlex® for MGI Single-Indexed PCR Primers are high-quality ready-to-use PCR primers for MGISEQ™ library construction. They are compatible and designed for use with all CleanPlex for MGI NGS Panels to construct targeted libraries for sequencing on an MGISEQ NGS platform.

Primer Sequences:

Each sample is indexed by a pair of Indexed PCR Primers for sequencing on MGISEQ platforms.
XXXXXXXXXX denotes the index region of the primer.

Universal Primer

5′-Phos-GAACGACATGGCTACGATCCGACT*T-3’

Indexed Primers

5′-TGTGAGCCAAGGAGTTGXXXXXXXXXXTTGTCTTCCTAAGACCGCTTGGCCTCCGACT*T-3’

Note:

Please refer to the CleanPlex for MGI NGS Panel User Guide for instructions on using CleanPlex for MGI Single-Indexed PCR Primers

 

Storage Temperature:

Store at -20°C

 

For Research Use Only. Not for use in diagnostic procedures.

Product Documents

Additional Information

Pack Size (Reactions)

Set A 32, Set B 32, Set C 32, Set D 32, Set E 32, Set F 32, Set A 96, Set B 96, Set C 96, Set D 96, Set E 96, Set F 96