CleanPlex® Dual-Indexed PCR Primers for Illumina®

$104.00$1,344.00

The CleanPlex® Dual-Indexed PCR Primers for Illumina® are high-quality ready-to-use PCR primers for Illumina library construction. They are compatible and designed for use with all CleanPlex and CleanPlex UMI NGS Panels to constructed targeted libraries for sequencing on an Illumina NGS platform.

SKU: N/A Category:

Product Description

The CleanPlex® Dual-Indexed PCR Primers for Illumina® are high-quality ready-to-use PCR primers for Illumina library construction. They are compatible and designed for use with all CleanPlex and CleanPlex UMI NGS Panels to constructed targeted libraries for sequencing on an Illumina NGS platform.

Primer Sequences:

i5 Indexed Primers

5’-AATGATACGGCGACCACCGAGATCTACACXXXXXXXXACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3′

i7 Indexed Primers

5’-CAAGCAGAAGACGGCATACGAGATXXXXXXXXGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3’

Note:

Please refer to CleanPlex NGS Panel User Guide for instructions on using CleanPlex Dual-Indexed PCR Primers for Illumina

 

Storage Temperature:

Store at -20°C

 

For Research Use Only. Not for use in diagnostic procedures.

Product Documents

Additional Information

WeightN/A
Rxns

Set A1 16, Set A 96, Set A 384, Set B 96, Set B 384

Related Products…