CleanPlex® Dual-Indexed PCR Primers for Illumina®

$108.00$368.00

CleanPlex® Dual-Indexed PCR Primers for Illumina® (Set A)  and (Set A1). CleanPlex™ Dual-Indexed PCR Primers for Illumina® (Set A1) are a subset of CleanPlex® Dual-Indexed PCR Primers for Illumina® (Set A).  Both sets are suitable for sample barcoding and optimized for multiplex sample preparation for next-generation sequencing on Illumina instruments.

Product Description

CleanPlex® Dual-Indexed PCR Primers for Illumina® are comprised of two sets — Set A and Set A1. CleanPlex® Dual-Indexed PCR Primers for Illumina® (Set A1) are a subset of CleanPlex® Dual-Indexed PCR Primers for Illumina® (Set A) for 16 and 96 combinations respectively.  Both sets are suitable for sample barcoding and optimized for multiplex sample preparation with CleanPlex® kits and other compatible library preparation protocols for next-generation sequencing on Illumina instruments.

Set components:

Each set of CleanPlex® Dual-Indexed PCR Primers for Illumina® contains:

  • Set A1: 4 tubes of i5 Primers + 4 tubes of i7 Primers, for 16 reactions
  • Set A: 8 tubes of i5 Primers + 12 tubes of i7 Primers, for 96 reactions

Technical Notes:

i5 Index Primers

5’-AATGATACGGCGACCACCGAGATCTACACXXXXXXXXACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3′

i7 Index Primers

5’-CAAGCAGAAGACGGCATACGAGATXXXXXXXXGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3’

Note: Please refer to the kit specific User Guide for instructions on using CleanPlex® Dual-Indexed PCR Primers for Illumina

Index 1 (i7) Sequence Index 2 (i5) Sequence
A701GTCGTGATA501TGAACCTT
A702ACCACTGTA502TGCTAAGT
A703TGGATCTGA503TGTTCTCT
A704CCGTTTGTA504TAAGACAC
A705TGCTGGGTA505CTAATCGA
A706GAGGGGTTA506CTAGAACA
A707AGGTTGGGA507TAAGTTCC
A708GTGTGGTGA508TAGACCTA
A709TGGGTTTC
A710TGGTCACA
A711TTGACCCT
A712CCACTCCT

 

Reagents and buffers required for DNA library preparation but not supplied:

  • CleanMag™ Magnetic Beads: #718001
  • DynaMag™ -96 Side (Thermo Fisher Scientific, 12331D) or other similar magnet for 96-well plate or 8/12-well strip tubes.
  • DNA LoBind Tubes/PCR tubes/96-well PCR Plates
  • Nuclease-free water
  • TE buffer
  • Bioanalyzer® (Agilent Technologies, Inc.)

Target enrichment kits  suitable for DNA library preparation:

Storage Temperature:

-20°C

Additional Information

Rxns

16, 96

No FAQ Found

You may also like…