CleanPlex® Single-Indexed PCR Primers for Ion Torrent™

$304.00$672.00

The CleanPlex® Single-Indexed PCR Primers for Ion Torrent™ are high-quality ready-to-use PCR primers for Ion Torrent library construction. They are compatible and designed for use with all CleanPlex NGS Panels to constructed targeted libraries for sequencing on an Ion Torrent NGS platform.

SKU: N/A Category:

Product Description

The CleanPlex® Single-Indexed PCR Primers for Ion Torrent™ are high-quality ready-to-use PCR primers for Ion Torrent library construction. They are compatible and designed for use with all CleanPlex NGS Panels to constructed targeted libraries for sequencing on an Ion Torrent NGS platform.

Primer Sequences

Each sample is indexed by two pairs of Indexed PCR Primers for sequencing on Ion Torrent platforms. XXXXXXXXX denotes the index region of the primer.

Indexed PCR Primers

5’-CCATCTCATCCCTGCGTGTCTCCGACTCAGXXXXXXXXXCGATTTCAGACGTGTGCTCTTCCGATC*T-3′

5’-CCATCTCATCCCTGCGTGTCTCCGACTCAGXXXXXXXXXCGATCCTACACGACGCTCTTCCGATC*T-3′

Universal PCR Primers

5’-CCGCTTTCCTCTCTATGGGCAGTCGGTGATTTCAGACGTGTGCTCTTCCGATC*T-3′

5’-CCGCTTTCCTCTCTATGGGCAGTCGGTGATCCTACACGACGCTCTTCCGATC*T-3′

Note:

Please refer to CleanPlex NGS Panel User Guide for instructions on using CleanPlex Single-Indexed PCR Primers for Ion Torrent

 

Storage Temperature:

Store at -20°C

 

For Research Use Only. Not for use in diagnostic procedures.

Product Documents

Additional Information

WeightN/A
Pack Size (Reactions)

Set A 32, Set A 96, Set B 32, Set B 96

Related Products…